Breadcrumb

Project
Incorporating Gastrointestinal Microbiome Analysis into Fish Nutritional Assessments

Dataset
Sablefish GI microbiome & histology

Dataset Description
Raw & refined classification & abundance data from array analysis & histology analysis

Data contact
Linda Rhodes

InPort Dataset Reference
View complete data set metadata: 18020

Table
Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets

Table description
These data were derived from a feeding study with juvenile sablefish, comparing plant-based feeds (flax, corn) with fish-based feed (reference). Intestinal microbiomes were determined by hybridization of a gastronintesntial DNA microarray.

InPort Entity Reference
View complete entity metadata: 56814

Web Service End Point
https://www.webapps.nwfsc.noaa.gov/apex/parr/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets/data/page/

Metadata Service End Point
https://www.webapps.nwfsc.noaa.gov/apex/parr/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets/metadata/all/

Source URL
https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets

Preferred Citation
Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)

Phylum (TEXT)
bacterial or archaeal phylum name. Units for values are NA.

Class (TEXT)
bacterial or archaeal class name. Units for values are NA.

Order (TEXT)
bacterial or archaeal order name. Units for values are NA.

Family (TEXT)
bacterial or archaeal family name. Units for values are NA.

Genus (TEXT)
bacterial or archaeal genus name. Units for values are NA.

Species (TEXT)
bacterial or archaeal species name. Units for values are NA.

Representative Gene (TEXT)
DNA sequence representative of taxon. Units for values are NA.

49b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

50b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

53b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

59b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

60b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

72b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

74b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

77b.1 (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

77b.2 (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

78b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

79b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

80b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

84b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

Corn (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

Flax (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

Ref (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

56a (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

74a (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

54c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

56c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

60c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

70c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

71c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

77c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

79c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

80c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.

Record Number (TEXT)
An indication of the total number of records in the data. Added to help indicate how much data should be expected when accessing or downloading, so end users know if they got all the data.

Accessed Date (TEXT)
The date on which this data was accessed or downloaded. Added when data is delivered to record when the data was downloaded.

Source Url (TEXT)
The human interface access point for this data table.

Preferred Citation (TEXT)
The preferred citation for this data table.

1 - 50 of 201

Phylum	Class	Order	Family	Genus	Species	Representative Gene	49b	50b	53b	59b	60b	72b	74b	77b.1	77b.2	78b	79b	80b	84b	Corn	Flax	Ref	56a	74a	54c	56c	60c	70c	71c	77c	79c	80c	Record Number	Accessed Date	Source Url	Preferred Citation
p__Chloroflexi	c__Anaerolineae	o__Anaerolineales	f__Anaerolinaceae	g__OPB11	s__unclassified	AGGAATTGACGGGACCGCACAAGCG CACGGCTAACTACGTGCCAAGCAGC CGGCTAACTACGTGCCAAGCAGCCG CTACGGTGCCAGCAGCCGCGGTAAT GGAAGCTCCGGGCTAACTACGTGCC-top	671	695	680	183	668	686	690	685	688	678	660	678	688	646	638	704	716	718	698	681	631	680	699	632	588	695	Row 1 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Enterobacteriales	f__Enterobacteriaceae	g__Pantoea	s__Pantoea_ananatis	CGGATGAACCCAGATGGGATTAGCT CGGATGAACCCAGATGGGATTAGCT CGGTGGCTAATACCGCATAACGTCG TCACTATCGGATGAACCCAGATGGG TCACTATCGGATGAACCCAGATGGG-top	192	192	130	239	540	170	68	91	134	257	157	221	236	592	692	676	158	61	278	110	650	71	49	270	292	129	Row 2 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Planctomycetes	c__Planctomycea	o__Planctomycetales	f__Planctomycetaceae	g__Planctomyces	s__unclassified	AACTAACGTGCCAGCAGCCGCGGTA AACTAACGTGCCAGCAGCCGCGGTA CCAGCAGCCGCGGTAATACTGGAGG TAACTAACGTGCCAGCAGCCGCGGT TAACTAACGTGCCAGCAGCCGCGGT-top	719	718	719	626	719	718	717	718	718	718	719	718	713	719	719	718	719	719	719	719	717	719	706	717	717	716	Row 3 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Bacteroidetes	c__Flavobacteria	o__Flavobacteriales	f__Flavobacteriaceae	g__Polaribacter	s__unclassified	AACCATATCACAGTTCGGATCGGAG AACCATATCACAGTTCGGATCGGAG ACAATGAGCAGCCATCTGGCAACAG AGGAGCCGCCTAGGTAAAACTGGTA ATTGCGAAGGCAGTCTACTACGTAT ATTGCGAAGGCAGTCTACTACGTAT GCTGGGAGTGCCTGAAGTCCGTCAC GCTGGGAGTGCCTGAAGTCCGTCAC GGCATTAGCTCAGTGACTAAGCGAA GGCATTAGCTCAGTGACTAAGCGAA GTATGGACAATGAGCAGCCATCTGG GTGCTTGCACCAGATGACGACCGGC GTGCTTGCACCAGATGACGACCGGC TGCCTTTGATACTGGTTGACTTGAG TGCCTTTGATACTGGTTGACTTGAG-top	55	38	68	180	44	52	132	46	102	102	96	63	72	103	422	58	42	47	679	551	701	688	686	567	455	659	Row 4 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Bacteroidetes	c__Flavobacteria	o__Flavobacteriales	f__Flavobacteriaceae	g__Polaribacter	s__unclassified	CAACTAGACTCCGTGAAGCTGGTAT CAGTGACTAAGCGAAAGTGATAAGT CAGTGACTAAGCGAAAGTGATAAGT TCAGTGACTAAGCGAAAGTGATAAG TCAGTGACTAAGCGAAAGTGATAAG-top	136	148	38	73	106	119	10	118	16	137	199	145	9	160	350	243	192	23	557	377	590	614	612	441	365	564	Row 5 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Bacteroidetes	c__Bacteroidia	o__Bacteroidales	f__Prevotellaceae	g__Prevotella	s__unclassified	ATGGGCGTAGGCCTGAACCAGCCAA CGAGAGTCTGAACCAGCCAAATCGC GAGAATCTGAACCAGCCAAGTAGCG GAGCCTGAACCAGCCAAGTGGCGTG GCCTGAACCAGCCAAGTAGCGTGAA TGGGCCGCGAGCCTGAACCAGCCAT TGGGCGTAGGCCTGAACCAGCCAAG-top	143	521	137	639	467	715	708	425	658	288	483	419	680	264	276	248	570	666	678	638	562	636	652	690	622	662	Row 6 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Pseudomonadaceae	g__Pseudomonas	s__unclassified	CGAGCGGTAGAGAGAAGCTTGCTTC GGCAGTTACCTAATACGTGATTGTT TCCAATGAACTTTCCAGAGATGGAT TCCAATGAACTTTCCAGAGATGGAT TGCTTCTCTTGAGAGCGGGCGGACC TGCTTCTCTTGAGAGCGGGCGGACC-top	105	66	126	550	89	112	78	92	89	47	130	115	212	411	459	419	63	3	88	64	418	47	93	149	336	42	Row 7 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Pseudomonadaceae	g__Pseudomonas	s__unclassified	AGGTGGTTTGTTAAGTTGAATGTGA ATGGCGCTCACCACGGTGTGGTTGA CCTTGAGCTCTTAGTGGCGCCAGCT GAACTGCATTCAAAACTGACTGACT GCAACGCGCAAAACTTTACCAGCCT TGCTCTGCAACTCGGGCACATGAAG-top	69	187	150	271	100	111	181	171	155	267	142	180	263	552	544	581	138	201	297	179	485	126	258	285	323	261	Row 8 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Pseudomonadaceae	g__Pseudomonas	s__unclassified	ATAAGCACCGGGCTAACTTCGTGCC CAGCACGTAATGGTGGGCACTCTGA CGAAGGCGGCCACCTGGACTGTAAC GGAATTACTGGCGTAAAGCGCGCGT TAAGCACCGGGCTAACTTCGTGCCA-top	262	354	274	177	349	446	256	264	301	390	263	307	362	335	419	222	208	217	241	279	424	338	309	435	522	300	Row 9 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Pseudomonadaceae	g__Pseudomonas	s__unclassified	CTTTCAGCGAGGCGGAAGGCATTAA CTTTCAGCGAGGCGGATAATGACGT TATCAAAAGCGAGGCGATCTGCTGG TGTCAACGGCAGGCCAATTAGAGTG TTAACGTTACCGCCTCGCTGCTCTT TTCGTGCCTCGCCCTATTGGATGAG-top	447	233	103	677	242	207	240	136	154	230	106	187	266	68	71	657	67	152	46	95	665	106	69	519	299	80	Row 10 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Pseudomonadaceae	g__Pseudomonas	s__unclassified	AACTGCATTCAAAACTGACTGACTA ACTGCATTCAAAACTGACTGACTAG ACTGCATTCAAAACTGACTGACTAG AGGGCAGTTACCTAATACGTGATTG AGGTGGTTTGTTAAGTTGAATGTGA CCGTTGGAAGCCTTGAGCTTTTAGT CCGTTGGAAGCCTTGAGCTTTTAGT CGAGCGGTAGAGAGAAGCTTGCTTC CGTTGGAAGCCTTGAGCTTTTAGTG CGTTGGAAGCCTTGAGCTTTTAGTG CTGCATTCAAAACTGACTGACTAGA CTGCATTCAAAACTGACTGACTAGA GCCGTTGGAAGCCTTGAGCTTTTAG GCCGTTGGAAGCCTTGAGCTTTTAG GGCAGTTACCTAATACGTGATTGTT-top	81	25	30	290	41	13	14	18	47	50	38	77	118	526	547	559	4	52	78	50	509	41	30	162	59	79	Row 11 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Pseudomonadaceae	g__Pseudomonas	s__unclassified	CGCGCCATTAGATGAGCCTAGGTCG GCCGTTGGATTCCTTGAGGATTTAG GCCGTTGGATTCCTTGAGGATTTAG TCGCGCCATTAGATGAGCCTAGGTC TCGCGCCATTAGATGAGCCTAGGTC-top	13	50	62	49	9	4	38	20	29	94	22	104	51	60	105	47	24	65	191	16	499	18	421	29	140	509	Row 12 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Pseudomonadaceae	g__Pseudomonas	s__unclassified	AGCCTGATCCACCATGCCGCGTGAG ATGGGTGAAAGCCTGATCCAGCCAT CCCGGGCTCAACCTGAGAACTGCAT GCTCAACCTGGGAACTGCCTCCAAA TGGCGAAGGCGACTTCCTGGACTCA TGGGTGAAAGCCTGATCCAGCCATG-top	686	690	613	435	656	688	599	643	623	656	592	635	529	575	603	649	612	706	588	555	624	567	663	409	406	591	Row 13 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Moraxellaceae	g__Psychrobacter	s__unclassified	AGCCTATCGTAGTCCAGATTGGAGT GAGCTCAAATACAGGTGCTGCATGG GATTGGATACAGGTGCTGCACGGCT GCGCACCATGGCGACGATCTGTAGC GCGCACGGGTGAGTAACGCATAGAT TACATACAGGTGCTGCACGGCTGTC TTTGGAGAAACTGCCGGTGACAAGC-top	365	322	262	186	248	248	274	253	295	361	253	299	323	501	461	308	202	233	192	268	413	355	335	428	492	344	Row 14 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Moraxellaceae	g__Psychrobacter	s__unclassified	AAAGCCTATCGTAGTCCAGATTGGA AACTGCATCAAAACTGGCAAGCTAG AAGTCGAGCGGCGGCACGGGTACTT ACCAGGCCTTGACATCCAATGAATC AGCCTATCGTAGTCCAGATTGGAGT AGGACTTAGTGACGCAGCTAACGCA ATGCGAATCTCAAAAAGCCTATCGT GGGTCCCTTGAGGACTTAGTGACGC GGGTCCCTTGAGGACTTAGTGACGC TACCAGGCCTTGACATCCAATGAAC TCCCTTGAGGACTTAGTGACGCAGC TCCCTTGAGGACTTAGTGACGCAGC-top	203	225	121	250	148	82	178	124	140	164	118	208	245	556	577	609	269	304	275	113	605	122	337	196	212	273	Row 15 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Alteromonadales	f__Shewanellaceae	g__Shewanella	s__unclassified	ACCTACTCTTGACATCCAGCGAATC AGTCGAGCGGTAACAGGAGAAGCTT AGTCGAGCGGTAACAGGAGAAGCTT ATTTGGAACTGGCAAACTAGAGTCT TCGAGCGGTAACAGGAGAAGCTTGC-top	160	169	442	41	120	317	70	437	386	581	522	290	337	559	549	617	544	319	463	563	482	578	507	619	641	574	Row 16 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Alphaproteobacteria	o__Sphingomonadales	f__Sphingomonadaceae	g__Sphingobium	s__unclassified	ATAACTAGCTGCCGGGGCACATGGT CTGCCTTTGAGACTGGATTGCTAGA CTGCCTTTGAGACTGGATTGCTAGA TGGCGACTACAGTGGGCAGCGACAC TGGCGACTACAGTGGGCAGCGACAC-top	151	712	47	193	76	226	230	85	70	155	63	131	353	65	77	513	211	606	432	40	60	75	187	76	1	116	Row 17 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Alphaproteobacteria	o__Sphingomonadales	f__Sphingomonadaceae	g__Sphingopyxis	s__unclassified	AGAATCTTGGAGAGGTCAGTGGAAT AGAATCTTGGAGAGGTCAGTGGAAT ATCTTGGAGAGGTCAGTGGAATTCC GAATCTTGGAGAGGTCAGTGGAATT GACTGACTGGACAAGTATTGACGCT GGCGACTGACTGGACAAGTATTGAC-top	135	67	8	490	548	136	101	31	96	95	632	78	43	49	126	484	286	467	48	112	68	162	54	83	6	43	Row 18 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Firmicutes	c__Bacilli	o__Bacillales	f__Staphylococcaceae	g__Staphylococcus	s__Staphylococcus_cohnii	CGCAGAGATATGGAGGACACCAGTG TAAGTTGGGCACTCTAAGTTGACTG TAAGTTGGGCACTCTAAGTTGACTG TTAAGTTGGGCACTCTAAGTTGACT TTAAGTTGGGCACTCTAAGTTGACT-top	631	63	141	11	261	578	338	202	497	278	535	159	265	166	101	329	152	91	50	378	219	32	105	58	191	97	Row 19 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Xanthomonadales	f__Xanthomonadaceae	g__Stenotrophomonas	s__unclassified	AGATCAGGAGGAACATCCGTGGCGA CCTTGCGCGATTGAATGAGCCGATG CCTTGCGCGATTGAATGAGCCGATG CGGCGACGGTAAGCCAATCCCAGAA CGGCGACGGTAAGCCAATCCCAGAA-top	116	146	92	408	690	134	243	141	169	166	82	168	389	569	618	53	502	136	59	88	77	93	440	108	20	81	Row 20 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Firmicutes	c__Bacilli	o__Lactobacillales	f__Streptococcaceae	g__Streptococcus	s__Streptococcus_pneumoniae	ACGCGTAGGTAACCTGCCTGGTAGC ACGCGTAGGTAACCTGCCTGGTAGC AGCGCAGGCGGTTAGATAAGTCTGA AGCGCAGGCGGTTAGATAAGTCTGA AGGCGGTTAGATAAGTCTGAAGTTA CACTACCAGATGGACCTGCGTTGTA CACTACCAGATGGACCTGCGTTGTA CGAGCGCAGGCGGTTAGATAAGTCT CGAGCGCAGGCGGTTAGATAAGTCT CGCAGGCGGTTAGATAAGTCTGAAG CGCAGGCGGTTAGATAAGTCTGAAG CTACCAGATGGACCTGCGTTGTATT CTACCAGATGGACCTGCGTTGTATT GGCGGTTAGATAAGTCTGAAGTTAA TAGAACGCTGAAGGAGGAGCTTGCT TAGAACGCTGAAGGAGGAGCTTGCT-top	414	667	562	213	361	191	206	99	418	85	580	694	249	238	257	409	205	112	74	538	69	63	208	80	37	90	Row 21 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Firmicutes	c__Bacilli	o__Lactobacillales	f__Streptococcaceae	g__Streptococcus	s__Streptococcus_cristatus	AAGCTAATCTCTTAAAGCCAGTCTC AGGCGGTTAGATAAGTCTGAAGTTA CCATAGTACGCTTTGGAAACTGTTT CCATAGTACGCTTTGGAAACTGTTT TAGTACGCTTTGGAAACTGTTTAAC TAGTACGCTTTGGAAACTGTTTAAC-top	219	512	377	417	181	41	22	100	159	101	311	564	214	111	117	49	75	28	42	272	6	34	83	59	97	18	Row 22 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Firmicutes	c__Bacilli	o__Lactobacillales	f__Streptococcaceae	g__Streptococcus	s__unclassified	GCCGGTGAGGTAACCTTTTAGGAGC GCCGGTGAGGTAACCTTTTAGGAGC TCGGTGAGGTAACCTATTAGGAGCC TGAGGTAACCTTTTCAGGAGCCAGC TGAGGTAACCTTTTCAGGAGCCAGC-top	472	201	367	133	376	546	109	435	383	211	247	361	112	195	183	207	102	121	269	251	165	155	64	106	171	61	Row 23 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Firmicutes	c__Bacilli	o__Lactobacillales	f__Streptococcaceae	g__Streptococcus	s__unclassified	AACTGACCAGAAAGGGACGGCTAAC AACTGACCAGAAAGGGACGGCTAAC ATCTCTTAAAGCCAATCTCAGTTCG ATCTCTTAAAGCCAATCTCAGTTCG GAAAGGGACGGCTAACTACTGCCAC GGTCCCGAGCGTTGTCTGGATTTAT TTACCAGAAAGGGACGGCTAACTAC TTACCAGAAAGGGACGGCTAACTAC-top	636	635	634	316	569	584	612	529	585	287	510	626	324	433	427	481	345	92	582	503	450	360	326	274	277	339	Row 24 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Firmicutes	c__Bacilli	o__Lactobacillales	f__Streptococcaceae	g__Streptococcus	s__Streptococcus_infantis	CTTGCTCTTCTGGATGAGTTGCGAA GCTCTTCTGGATGAGTTGCGAACGG GCTTGCTCTTCTGGATGAGTTGCGA GCTTGCTCTTCTGGATGAGTTGCGA TGCTCTTCTGGATGAGTTGCGAACG TGCTCTTCTGGATGAGTTGCGAACG-top	591	314	703	26	516	36	182	50	604	65	210	434	198	305	104	429	91	19	7	219	7	14	26	38	128	15	Row 25 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Actinobacteria	c__Actinobacteria	o__Actinomycetales	f__unclassified	g__unclassified	s__unclassified	AAGCACCGGCTAACTACGTCCAGCA AGCACCGCTAACTACGTGCCAGCAG CATGCTGGATTAATTCGATGCAACG CGGCTAACTACGTGCCAGCAAGCCG CTACGTGCCAGACAGCCGCGGTAAT GAAGCACCGCTAACTACGTGCCAGC TAAGCCACCGGCTAACTACGTGCCA-top	706	707	689	623	698	693	701	699	692	695	692	711	708	610	625	698	711	717	697	697	649	700	711	667	627	706	Row 26 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Actinobacteria	c__Actinobacteria	o__Acidimicrobiales	f__Acidimicrobiaceae	g__unclassified	s__unclassified	AAAGTGGCAACACCCGAAGCCGGTG ACGAAAGTGGCAACACCCGAAGCCG ACGAAAGTGGCAACACCCGAAGCCG CGAAAGTGGCAACACCCGAAGCCGG CGAAAGTGGCAACACCCGAAGCCGG-top	426	298	348	505	459	581	404	472	266	324	459	359	632	180	165	266	618	373	101	241	137	66	142	85	214	122	Row 27 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__unclassified	f__unclassified	g__unclassified	s__unclassified	AACGCTGTCTACTAGCTGTTTGTGG AACGCTGTCTACTAGCTGTTTGTGG ATCCGTAGAGATGCGAAGGAACACC ATGGTTAATACCCATTAGCTGTGAC ATGGTTAATACCCATTAGCTGTGAC CCTAAGCGAGATTAGCTTGTTGGTG GGAGAGATCCATGGTTCCCTTCGGG GGAGAGATCCATGGTTCCCTTCGGG GGGTAAAATCCGTAGAGATGCGAAG TAAGCGAGATTAGCTTGTTGGTGAG TGGAGAGATCCATGGTTCCCTTCGG-top	66	84	28	519	67	20	36	47	18	21	67	73	149	38	25	67	28	43	327	72	12	526	556	16	13	478	Row 28 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Rhodocyclales	f__Rhodocyclaceae	g__unclassified	s__unclassified	AAATCGCATCAGCTAATACCTGGTG AAATCGCATCAGCTAATACCTGGTG AAGAAATCGCATCAGCTAATACCTG AAGAAATCGCATCAGCTAATACCTG ATACCGCATATTCTGTGAGCAGGAA ATACCGCATATTCTGTGAGCAGGAA CCGCATATTCTGTGAGCAGGAAAGC CCGCATATTCTGTGAGCAGGAAAGC CGGGAAGAAATCGCATCAGCTAATA CGGGAAGAAATCGCATCAGCTAATA CGGTTGTGTAAGACAGGCGTGAAAT CGGTTGTGTAAGACAGGCGTGAAAT GACATGTCCAGAAGCCCGAAGAGAT GCCGGGAAGAAATCGCATCAGCTAA GCCGGGAAGAAATCGCATCAGCTAA-top	644	609	642	138	663	40	20	679	654	663	241	601	32	77	17	577	249	562	127	354	233	11	240	33	240	327	Row 29 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__unclassified	f__unclassified	g__unclassified	s__unclassified	AATTGGTTGAGTTGCTTCTTCTGGC AATTGGTTGAGTTGCTTCTTCTGGC CCAGAAGTTGCTGGGCTAACTCCGT GTCGGAGTTGCTGGTATCGCAGGTC TAGTAACCGCAACTCAGCATATTGC TCAAGGAACCCAGCAACTAGTTGAC-top	90	531	115	291	109	224	447	72	143	67	90	196	635	14	8	68	396	601	179	205	152	317	236	445	273	347	Row 30 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Bacteroidetes	c__Flavobacteria	o__Flavobacteriales	f__Flavobacteriaceae	g__unclassified	s__unclassified	ACAATGAGCAGCCATCTGGCAACAG AGGTTTAGAGATAGACTTTTCTTCG AGGTTTAGAGATAGACTTTTCTTCG GGTGAAAGGTTGTCGCTTAACGATA TGGTGAAAGGTTGTCGCTTAACGAT-top	43	85	44	449	46	32	34	43	113	82	59	84	351	29	43	64	30	44	449	105	611	592	535	446	430	531	Row 31 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Comamonadaceae	g__unclassified	s__unclassified	ATGCAAGTCGAACGGTAACGGGCCT CATGCAGTCGAACGGTAACAGGGAA CCAAGCCGACGATCTAGTAGCTAGG CCTTATAGGTGGGGCTACACACGTC GCAAGTCGAACGGTAACGGGCCTTC TACCAAGCCGACGATCTAGTAGCTA TGCCGCGTGCAGGAAGAAGGCCCTA-top	583	642	590	503	653	562	496	594	630	643	584	603	306	442	395	545	414	561	368	542	446	445	388	500	533	364	Row 32 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__unclassified	o__unclassified	f__unclassified	g__unclassified	s__unclassified	ACGCTCATGCACGAAAGCTGGGGAG AGTAGCTGGCCTGAGAGGACGACCA CAGTAGCTGGCCTGAGAGGACGACC CTGACGCTCATGCACGAAAAGCGTG GAATTCTGGGCGTAAAGCGTGCGCA GCCGGTCTCAGTTCGGATTAGAGTC GTTGAGCCCGGGGATTTTACACCTG-top	658	681	622	67	678	650	635	621	625	624	604	649	668	547	530	579	382	586	388	487	532	320	291	383	447	279	Row 33 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Firmicutes	c__Clostridia	o__Clostridiales	f__Lachnospiraceae	g__unclassified	s__unclassified	ACCAGGTCTTGACATCCCGAGAAGT ACCAGGTCTTGACATCCCGAGAAGT ACCAGGTCTTGACATCCCGATGAAA ACCAGGTCTTGACATCCCGATGAAA ACCAGGTCTTGACATCCGATGCATA TGGTGCCGCTGCTAACGCATTAAGC-top	577	511	514	366	481	290	313	215	555	250	294	441	197	304	274	348	475	264	437	259	205	210	225	137	91	105	Row 34 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Comamonadaceae	g__unclassified	s__unclassified	ACACGTCATACAATGGCTGGAGCAA AGCTTTGCTAATACCGCATACGATC GCGCTTGTGACTGCAAAGCTGGAGT GCGCTTGTGACTGCAAAGCTGGAGT GTACGGAACGAAAAGGCTCTGGTTA GTACGGAACGAAAAGGCTCTGGTTA-top	358	526	475	179	538	323	244	442	398	422	354	531	151	115	95	327	239	441	117	274	76	107	192	133	310	35	Row 35 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Comamonadaceae	g__Acidovorax	s__unclassified	AACCTGGGGAACTGCATTTGTGACT ACCTGGGGAACTGCATTTGTGACTG AGCGAAAGCTTTGCTAATACCGCAT AGCGAAAGCTTTGCTAATACCGCAT AGCTTTGCTAATACCGCATACGATC AGGCGAAAGCTTTGCTAATACCGCA AGGCGAAAGCTTTGCTAATACCGCA CAACCTGGGGAACTGCATTTGTGAC CGAACGGTAACAGGATCTTCGGATG GCGAAAGCTTTGCTAATACCGCATA GCGAAAGCTTTGCTAATACCGCATA GGCGAAAGCTTTGCTAATACCGCAT GGCGAAAGCTTTGCTAATACCGCAT GGGAACTGCATTTGTGACTGTATGG GGTAACAGGTTCTTCGGATGCTGAC GGTAACAGGTTTTCGGATGCTGACG TCGAGCGGTAACAGGTCTTCGGATG-top	637	652	589	152	654	645	382	617	607	623	540	582	39	119	115	592	460	617	330	477	289	267	327	250	330	233	Row 36 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Comamonadaceae	g__Acidovorax	s__unclassified	AACCCTTGCCATTAGTTGCTACGAA ACGTACTAACGCGTGAAGTTGACCG CCACCTTTGACATGTACGAAATCCT CCTTCGGGTTGTAAACTGCTCTTGT CCTTCGGGTTGTAAACTGCTCTTGT CGTGCGCAGGCGGTTATATCAGACC GACATGTACGGAATCCTTTAGAGAT GACATGTACGGAATCCTTTAGAGAT GGTGAGTTATACATCGGAACGTGCC GTAACGAGCTAACGCGTGAAGTTGA GTTCTCTGGGCCTGTACTGACGCTG TAAAGCGTGCGCAGGCGGCTATCCA TAAAGCGTGCGCAGGCGGCTATGTA TGTTACCCACCTTTGACATGTACGG TTCTGACGCTCATGCACGATAGCGT TTGCCAATAGTTGCTACGAAAGGGC-top	523	540	360	392	534	482	366	396	508	496	345	463	259	209	169	316	214	393	121	264	196	121	200	136	229	173	Row 37 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Comamonadaceae	g__Acidovorax	s__unclassified	ACGCTCATGCACGAAATCGTGGGGA CGTGCGCAGGCGGTTATATCAGACC CTACGGATGAAAGCAGGGGATCGCA GTTCTCTGGGCCTGTACTGACGCTG TGCTTCGAGAGAGCCGTAACACAGG TGCTTTTGTACGGAACGAAATAGCT-top	423	480	236	48	396	431	380	287	373	413	226	350	566	214	143	263	243	421	97	209	138	123	185	90	120	156	Row 38 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Comamonadaceae	g__Acidovorax	s__unclassified	AGTACGGCGCAAGGTTGAAACTCAA ATCTCGAAAGCCGATCTCAGTTCGG CGAAAGGGCACTCTATTGGGACTGC GAGTACGGCGCAAGGTTGAAACTCA GGAGTACGGCGCAAGGTTGAAACTC GGCCGCGAGGTTGAAACTCAAAGGA GGTTCTCTGGGCCTGTACTGACGCT GTAACGAAGCTAACGGCGTGAAGTT GTACGGCGCAAGGTTGAAACTCAAA TAACGAAGCTAACGGCGTGAAGTTG TCCGTTGATATGCGGAGGAACACCA-top	503	510	327	236	508	459	363	398	473	520	366	446	45	205	179	202	179	327	122	262	195	137	99	128	276	143	Row 39 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Moraxellaceae	g__Acinetobacter	s__unclassified	AACGCCGCGTGAGTCATGAAGGTTT AGGAATACCCGATGGCGAAGGCAGC AGGAATACCGATGGCGAAAGCAGCC ATATGGAAGAATACCAGTGGCGAAG ATGCCTTAACATGCAAGTCGAACGG ATGCTCGAAAGCGTGGGTAGCAAAC CACATGCAAGTTGAACGGCAGCATG CGTAAAGCGTGCGTAGGCGGTTACT CGTAAAGCGTGCGTAGGCGGTTATT GCCTTACACATGCAAGTTCGAACGG GGCCTTAACTGACGCTGAGGTACGA TGGAGGAATACCGATCGCGAAGGCA TGGTAACGGCGCACCAAGGCGAAGA-top	538	594	402	185	531	574	614	492	404	407	355	556	535	370	385	544	470	618	375	394	312	376	540	278	345	453	Row 40 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Pseudomonadales	f__Moraxellaceae	g__Acinetobacter	s__Acinetobacter_johnsonii	ATCTTCGGACCTTGCGCTACAGGGG CGGAGGAATACCGATGGCGCAGGCA GACGTTACGGCAGAATAAGCACCGG GCTAATACCGCATACGCCTACGGGG GTGGTGCAGCTAACGCGATAAGTAG TCGGGCCTTAGTGGCGCAGCTAACG TGTGACGTTACTCGCAGAATAAGCA-top	444	475	400	173	412	457	521	370	175	326	298	529	66	301	284	332	216	347	282	317	256	242	308	148	241	319	Row 41 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Aeromonadales	f__Aeromonadaceae	g__Aeromonas	s__Aeromonas_encheleia	GAATTGCATTTAAAACTGTCCAGCT GAATTGCATTTAAAACTGTCCAGCT GGAATTGCATTTAAAACTGTCCAGC TGCATTTAAAACTGTCCAGCTAGAG TGCATTTAAAACTGTCCAGCTAGAG-top	10	33	10	107	49	19	79	66	79	46	49	64	22	609	571	413	6	396	637	48	108	172	76	189	70	11	Row 42 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Aeromonadales	f__Aeromonadaceae	g__Aeromonas	s__unclassified	AAAGCACTTTCAGCGAGGAGGAAAG AACTGCCAGCTGTGACGTTACTCGC AACTGCCAGCTGTGACGTTACTCGC ATCTACTGGCTGTGACGTTACTCGC CGCGCGTAGCGTGGTTTGTTAAGTT CTTTCAGCGAGGAGGAAAGGTTGTA-top	140	186	109	248	215	222	272	129	144	175	91	174	146	588	568	445	68	245	540	181	260	322	418	190	285	433	Row 43 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Gammaproteobacteria	o__Vibrionales	f__Vibrionaceae	g__Aliivibrio	s__unclassified	AACTGGTGAACTAGAGTGCTGTAGA GAAACTGGTGAACTAGAGTGCTGTA GGAGAACGCTCACCACTTTGTGGTT GGAGAACGCTCACCACTTTGTGGTT TCGGGGAGGACGCTCACCACTTTGT-top	114	155	1	612	39	118	201	57	125	195	517	439	436	48	112	134	555	553	503	565	273	521	653	487	652	675	Row 44 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Tenericutes	c__Erysipelotrichi	o__Erysipelotrichales	f__Erysipelotrichaceae	g__Allobaculum	s__Allobaculum_sp_ID4	CCTTCGGGTCTCCAGTGGCGAACGG GAATGATTGGGCGTAAAGCATCTGT TTCGGATATCCAGTGGCGAACGGGT TTCGGATATCCAGTGGCGAACGGGT TTGTCTTTCCAGTGGCGAACGGGTG TTGTCTTTCCAGTGGCGAACGGGTG-top	535	286	322	206	298	257	293	216	225	306	287	313	414	708	701	673	178	173	598	213	706	190	167	506	313	263	Row 45 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Alphaproteobacteria	o__Rhodobacterales	f__Rhodobacteraceae	g__Antarctobacter	s__Antarctobacter_heliothermus	AACTGCCTCATAAACTCCTGGTCTT AACTGCCTCATAAACTCCTGGTCTT ACTGCCTCATAAACTCCTGGTCTTG ACTGCCTCATAAACTCCTGGTCTTG CTGCCTCATAAACTCCTGGTCTTGA CTGCCTCATAAACTCCTGGTCTTGA-top	70	55	261	119	23	81	125	26	83	127	14	27	54	12	253	7	100	190	607	70	604	640	647	370	332	537	Row 46 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Aquabacteriaceae	g__Aquabacterium	s__unclassified	AAAGCGTACGCAGGCGGCTTTGCAA AAAGCGTACGCAGGCGGCTTTGCAA AATTTCGCAGAGATGTGGAAGTGCT ATACCTCGGGAGGATGACGGTACCT CTAATCCCAGAAAACCGGTCGTAGT GATGACGTCAGGTCCTCATGGCCTT-top	354	608	324	362	574	193	470	456	586	536	471	442	318	105	114	367	242	414	106	376	299	139	196	114	291	141	Row 47 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Aquabacteriaceae	g__Aquabacterium	s__unclassified	AATGGCCGGTACAGAGGGCTCCGAT ATGCCGCGTGCAGGAAGAAGATCCT CTACAATGGCCGGTACAGTGGGCGT CTTCGCGAGGAGGAGCCAATCCCAA GCAATACCGCGTGCAGGAAGAAGGC GCCAACCAGCGAGGGGGAGCCAATC GGTAAAGGCCTACCAAGGCAGAGAT-top	474	562	405	91	562	318	459	461	560	540	475	501	423	226	225	313	236	401	183	329	294	265	243	150	314	210	Row 48 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Aquabacteriaceae	g__Aquabacterium	s__unclassified	AATACCTCGGGAGGATGACGGTACC AATACCTCGGGAGGATGACGGTACC ACCTGCAAAGGAGGGCGATTACCAC ATACCTCGGGAGGATGACGGTACCT TGCAGAAGATGTGGAAGTGCTCCGA-top	245	448	228	27	377	128	227	270	438	393	254	349	364	125	70	171	122	283	96	199	144	108	117	95	87	108	Row 49 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)
p__Proteobacteria	c__Betaproteobacteria	o__Burkholderiales	f__Comamonadaceae	g__Aquamonas	s__unclassified	AATGGGCGCAGCCTGATCCAGCCAT ACGTTTCGTAGTCCGGATCGCAGTC ATGGGCGCAGCCTGATCCAGCCATG GGGATGACTCAAGTCCTCATGGCCC GGGATGACTGTCAAGTCCTCATGGC-top	573	624	573	24	585	596	608	611	536	553	577	548	652	504	503	590	553	661	647	439	473	595	683	424	390	578	Row 50 of 201	Accessed on 2024-04-26 10:13:28	https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets	Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (https://www.webapps.nwfsc.noaa.gov/apex/parrdata/inventory/tables/table/comparative_bacterial_and_archaeal_gastrointestinal_abundances_from_sablefish_on_different_diets)

1 - 50 of 201