
Incorporating Gastrointestinal Microbiome Analysis into Fish Nutritional Assessments
Sablefish GI microbiome & histology
Dataset Description
Raw & refined classification & abundance data from array analysis & histology analysis
Data contact
Linda Rhodes
InPort Dataset Reference
View complete data set metadata: 18020
Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets
Table description
These data were derived from a feeding study with juvenile sablefish, comparing plant-based feeds (flax, corn) with fish-based feed (reference). Intestinal microbiomes were determined by hybridization of a gastronintesntial DNA microarray.
InPort Entity Reference
View complete entity metadata: 56814
Web Service End Point
Metadata Service End Point
Source URL
Preferred Citation
Rhodes, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
Phylum (TEXT)
bacterial or archaeal phylum name. Units for values are NA.
Class (TEXT)
bacterial or archaeal class name. Units for values are NA.
Order (TEXT)
bacterial or archaeal order name. Units for values are NA.
Family (TEXT)
bacterial or archaeal family name. Units for values are NA.
Genus (TEXT)
bacterial or archaeal genus name. Units for values are NA.
Species (TEXT)
bacterial or archaeal species name. Units for values are NA.
Representative Gene (TEXT)
DNA sequence representative of taxon. Units for values are NA.
49b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
50b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
53b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
59b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
60b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
72b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
74b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
77b.1 (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
77b.2 (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
78b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
79b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
80b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
84b (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
relative within-sample abundance for taxon. Units for values are NA.
relative within-sample abundance for taxon. Units for values are NA.
relative within-sample abundance for taxon. Units for values are NA.
56a (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
74a (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
54c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
56c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
60c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
70c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
71c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
77c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
79c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
80c (NUMBER)
relative within-sample abundance for taxon. Units for values are NA.
Record Number (TEXT)
An indication of the total number of records in the data. Added to help indicate how much data should be expected when accessing or downloading, so end users know if they got all the data.
Accessed Date (TEXT)
The date on which this data was accessed or downloaded. Added when data is delivered to record when the data was downloaded.
Source Url (TEXT)
The human interface access point for this data table.
Preferred Citation (TEXT)
The preferred citation for this data table.


  • 1 - 50 of 201
PhylumClassOrderFamilyGenusSpeciesRepresentative Gene49b50b53b59b60b72b74b77b.177b.278b79b80b84bCornFlaxRef56a74a54c56c60c70c71c77c79c80cRecord NumberAccessed DateSource UrlPreferred Citation
p__Chloroflexic__Anaerolineaeo__Anaerolinealesf__Anaerolinaceaeg__OPB11s__unclassifiedAGGAATTGACGGGACCGCACAAGCG CACGGCTAACTACGTGCCAAGCAGC CGGCTAACTACGTGCCAAGCAGCCG CTACGGTGCCAGCAGCCGCGGTAAT GGAAGCTCCGGGCTAACTACGTGCC-top671695680183668686690685688678660678688646638704716718698681631680699632588695Row 1 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Enterobacterialesf__Enterobacteriaceaeg__Pantoeas__Pantoea_ananatisCGGATGAACCCAGATGGGATTAGCT CGGATGAACCCAGATGGGATTAGCT CGGTGGCTAATACCGCATAACGTCG TCACTATCGGATGAACCCAGATGGG TCACTATCGGATGAACCCAGATGGG-top1921921302395401706891134257157221236592692676158612781106507149270292129Row 2 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Planctomycetesc__Planctomyceao__Planctomycetalesf__Planctomycetaceaeg__Planctomycess__unclassifiedAACTAACGTGCCAGCAGCCGCGGTA AACTAACGTGCCAGCAGCCGCGGTA CCAGCAGCCGCGGTAATACTGGAGG TAACTAACGTGCCAGCAGCCGCGGT TAACTAACGTGCCAGCAGCCGCGGT-top719718719626719718717718718718719718713719719718719719719719717719706717717716Row 3 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Bacteroidetesc__Flavobacteriao__Flavobacterialesf__Flavobacteriaceaeg__Polaribacters__unclassifiedAACCATATCACAGTTCGGATCGGAG AACCATATCACAGTTCGGATCGGAG ACAATGAGCAGCCATCTGGCAACAG AGGAGCCGCCTAGGTAAAACTGGTA ATTGCGAAGGCAGTCTACTACGTAT ATTGCGAAGGCAGTCTACTACGTAT GCTGGGAGTGCCTGAAGTCCGTCAC GCTGGGAGTGCCTGAAGTCCGTCAC GGCATTAGCTCAGTGACTAAGCGAA GGCATTAGCTCAGTGACTAAGCGAA GTATGGACAATGAGCAGCCATCTGG GTGCTTGCACCAGATGACGACCGGC GTGCTTGCACCAGATGACGACCGGC TGCCTTTGATACTGGTTGACTTGAG TGCCTTTGATACTGGTTGACTTGAG-top553868180445213246102102966372103422584247679551701688686567455659Row 4 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Bacteroidetesc__Flavobacteriao__Flavobacterialesf__Flavobacteriaceaeg__Polaribacters__unclassifiedCAACTAGACTCCGTGAAGCTGGTAT CAGTGACTAAGCGAAAGTGATAAGT CAGTGACTAAGCGAAAGTGATAAGT TCAGTGACTAAGCGAAAGTGATAAG TCAGTGACTAAGCGAAAGTGATAAG-top13614838731061191011816137199145916035024319223557377590614612441365564Row 5 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Bacteroidetesc__Bacteroidiao__Bacteroidalesf__Prevotellaceaeg__Prevotellas__unclassifiedATGGGCGTAGGCCTGAACCAGCCAA CGAGAGTCTGAACCAGCCAAATCGC GAGAATCTGAACCAGCCAAGTAGCG GAGCCTGAACCAGCCAAGTGGCGTG GCCTGAACCAGCCAAGTAGCGTGAA TGGGCCGCGAGCCTGAACCAGCCAT TGGGCGTAGGCCTGAACCAGCCAAG-top143521137639467715708425658288483419680264276248570666678638562636652690622662Row 6 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Pseudomonadaceaeg__Pseudomonass__unclassifiedCGAGCGGTAGAGAGAAGCTTGCTTC GGCAGTTACCTAATACGTGATTGTT TCCAATGAACTTTCCAGAGATGGAT TCCAATGAACTTTCCAGAGATGGAT TGCTTCTCTTGAGAGCGGGCGGACC TGCTTCTCTTGAGAGCGGGCGGACC-top1056612655089112789289471301152124114594196338864418479314933642Row 7 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Pseudomonadaceaeg__Pseudomonass__unclassifiedAGGTGGTTTGTTAAGTTGAATGTGA ATGGCGCTCACCACGGTGTGGTTGA CCTTGAGCTCTTAGTGGCGCCAGCT GAACTGCATTCAAAACTGACTGACT GCAACGCGCAAAACTTTACCAGCCT TGCTCTGCAACTCGGGCACATGAAG-top69187150271100111181171155267142180263552544581138201297179485126258285323261Row 8 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Pseudomonadaceaeg__Pseudomonass__unclassifiedATAAGCACCGGGCTAACTTCGTGCC CAGCACGTAATGGTGGGCACTCTGA CGAAGGCGGCCACCTGGACTGTAAC GGAATTACTGGCGTAAAGCGCGCGT TAAGCACCGGGCTAACTTCGTGCCA-top262354274177349446256264301390263307362335419222208217241279424338309435522300Row 9 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Pseudomonadaceaeg__Pseudomonass__unclassifiedCTTTCAGCGAGGCGGAAGGCATTAA CTTTCAGCGAGGCGGATAATGACGT TATCAAAAGCGAGGCGATCTGCTGG TGTCAACGGCAGGCCAATTAGAGTG TTAACGTTACCGCCTCGCTGCTCTT TTCGTGCCTCGCCCTATTGGATGAG-top44723310367724220724013615423010618726668716576715246956651066951929980Row 10 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Pseudomonadaceaeg__Pseudomonass__unclassifiedAACTGCATTCAAAACTGACTGACTA ACTGCATTCAAAACTGACTGACTAG ACTGCATTCAAAACTGACTGACTAG AGGGCAGTTACCTAATACGTGATTG AGGTGGTTTGTTAAGTTGAATGTGA CCGTTGGAAGCCTTGAGCTTTTAGT CCGTTGGAAGCCTTGAGCTTTTAGT CGAGCGGTAGAGAGAAGCTTGCTTC CGTTGGAAGCCTTGAGCTTTTAGTG CGTTGGAAGCCTTGAGCTTTTAGTG CTGCATTCAAAACTGACTGACTAGA CTGCATTCAAAACTGACTGACTAGA GCCGTTGGAAGCCTTGAGCTTTTAG GCCGTTGGAAGCCTTGAGCTTTTAG GGCAGTTACCTAATACGTGATTGTT-top8125302904113141847503877118526547559452785050941301625979Row 11 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Pseudomonadaceaeg__Pseudomonass__unclassifiedCGCGCCATTAGATGAGCCTAGGTCG GCCGTTGGATTCCTTGAGGATTTAG GCCGTTGGATTCCTTGAGGATTTAG TCGCGCCATTAGATGAGCCTAGGTC TCGCGCCATTAGATGAGCCTAGGTC-top135062499438202994221045160105472465191164991842129140509Row 12 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Pseudomonadaceaeg__Pseudomonass__unclassifiedAGCCTGATCCACCATGCCGCGTGAG ATGGGTGAAAGCCTGATCCAGCCAT CCCGGGCTCAACCTGAGAACTGCAT GCTCAACCTGGGAACTGCCTCCAAA TGGCGAAGGCGACTTCCTGGACTCA TGGGTGAAAGCCTGATCCAGCCATG-top686690613435656688599643623656592635529575603649612706588555624567663409406591Row 13 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Moraxellaceaeg__Psychrobacters__unclassifiedAGCCTATCGTAGTCCAGATTGGAGT GAGCTCAAATACAGGTGCTGCATGG GATTGGATACAGGTGCTGCACGGCT GCGCACCATGGCGACGATCTGTAGC GCGCACGGGTGAGTAACGCATAGAT TACATACAGGTGCTGCACGGCTGTC TTTGGAGAAACTGCCGGTGACAAGC-top365322262186248248274253295361253299323501461308202233192268413355335428492344Row 14 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Moraxellaceaeg__Psychrobacters__unclassifiedAAAGCCTATCGTAGTCCAGATTGGA AACTGCATCAAAACTGGCAAGCTAG AAGTCGAGCGGCGGCACGGGTACTT ACCAGGCCTTGACATCCAATGAATC AGCCTATCGTAGTCCAGATTGGAGT AGGACTTAGTGACGCAGCTAACGCA ATGCGAATCTCAAAAAGCCTATCGT GGGTCCCTTGAGGACTTAGTGACGC GGGTCCCTTGAGGACTTAGTGACGC TACCAGGCCTTGACATCCAATGAAC TCCCTTGAGGACTTAGTGACGCAGC TCCCTTGAGGACTTAGTGACGCAGC-top20322512125014882178124140164118208245556577609269304275113605122337196212273Row 15 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Alteromonadalesf__Shewanellaceaeg__Shewanellas__unclassifiedACCTACTCTTGACATCCAGCGAATC AGTCGAGCGGTAACAGGAGAAGCTT AGTCGAGCGGTAACAGGAGAAGCTT ATTTGGAACTGGCAAACTAGAGTCT TCGAGCGGTAACAGGAGAAGCTTGC-top1601694424112031770437386581522290337559549617544319463563482578507619641574Row 16 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Alphaproteobacteriao__Sphingomonadalesf__Sphingomonadaceaeg__Sphingobiums__unclassifiedATAACTAGCTGCCGGGGCACATGGT CTGCCTTTGAGACTGGATTGCTAGA CTGCCTTTGAGACTGGATTGCTAGA TGGCGACTACAGTGGGCAGCGACAC TGGCGACTACAGTGGGCAGCGACAC-top15171247193762262308570155631313536577513211606432406075187761116Row 17 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Alphaproteobacteriao__Sphingomonadalesf__Sphingomonadaceaeg__Sphingopyxiss__unclassifiedAGAATCTTGGAGAGGTCAGTGGAAT AGAATCTTGGAGAGGTCAGTGGAAT ATCTTGGAGAGGTCAGTGGAATTCC GAATCTTGGAGAGGTCAGTGGAATT GACTGACTGGACAAGTATTGACGCT GGCGACTGACTGGACAAGTATTGAC-top13567849054813610131969563278434912648428646748112681625483643Row 18 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Firmicutesc__Bacillio__Bacillalesf__Staphylococcaceaeg__Staphylococcuss__Staphylococcus_cohniiCGCAGAGATATGGAGGACACCAGTG TAAGTTGGGCACTCTAAGTTGACTG TAAGTTGGGCACTCTAAGTTGACTG TTAAGTTGGGCACTCTAAGTTGACT TTAAGTTGGGCACTCTAAGTTGACT-top63163141112615783382024972785351592651661013291529150378219321055819197Row 19 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Xanthomonadalesf__Xanthomonadaceaeg__Stenotrophomonass__unclassifiedAGATCAGGAGGAACATCCGTGGCGA CCTTGCGCGATTGAATGAGCCGATG CCTTGCGCGATTGAATGAGCCGATG CGGCGACGGTAAGCCAATCCCAGAA CGGCGACGGTAAGCCAATCCCAGAA-top116146924086901342431411691668216838956961853502136598877934401082081Row 20 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Firmicutesc__Bacillio__Lactobacillalesf__Streptococcaceaeg__Streptococcuss__Streptococcus_cristatusAAGCTAATCTCTTAAAGCCAGTCTC AGGCGGTTAGATAAGTCTGAAGTTA CCATAGTACGCTTTGGAAACTGTTT CCATAGTACGCTTTGGAAACTGTTT TAGTACGCTTTGGAAACTGTTTAAC TAGTACGCTTTGGAAACTGTTTAAC-top21951237741718141221001591013115642141111174975284227263483599718Row 22 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Firmicutesc__Bacillio__Lactobacillalesf__Streptococcaceaeg__Streptococcuss__unclassifiedGCCGGTGAGGTAACCTTTTAGGAGC GCCGGTGAGGTAACCTTTTAGGAGC TCGGTGAGGTAACCTATTAGGAGCC TGAGGTAACCTTTTCAGGAGCCAGC TGAGGTAACCTTTTCAGGAGCCAGC-top4722013671333765461094353832112473611121951832071021212692511651556410617161Row 23 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Firmicutesc__Bacillio__Lactobacillalesf__Streptococcaceaeg__Streptococcuss__unclassifiedAACTGACCAGAAAGGGACGGCTAAC AACTGACCAGAAAGGGACGGCTAAC ATCTCTTAAAGCCAATCTCAGTTCG ATCTCTTAAAGCCAATCTCAGTTCG GAAAGGGACGGCTAACTACTGCCAC GGTCCCGAGCGTTGTCTGGATTTAT TTACCAGAAAGGGACGGCTAACTAC TTACCAGAAAGGGACGGCTAACTAC-top63663563431656958461252958528751062632443342748134592582503450360326274277339Row 24 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Firmicutesc__Bacillio__Lactobacillalesf__Streptococcaceaeg__Streptococcuss__Streptococcus_infantisCTTGCTCTTCTGGATGAGTTGCGAA GCTCTTCTGGATGAGTTGCGAACGG GCTTGCTCTTCTGGATGAGTTGCGA GCTTGCTCTTCTGGATGAGTTGCGA TGCTCTTCTGGATGAGTTGCGAACG TGCTCTTCTGGATGAGTTGCGAACG-top5913147032651636182506046521043419830510442991197219714263812815Row 25 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Actinobacteriac__Actinobacteriao__Actinomycetalesf__unclassifiedg__unclassifieds__unclassifiedAAGCACCGGCTAACTACGTCCAGCA AGCACCGCTAACTACGTGCCAGCAG CATGCTGGATTAATTCGATGCAACG CGGCTAACTACGTGCCAGCAAGCCG CTACGTGCCAGACAGCCGCGGTAAT GAAGCACCGCTAACTACGTGCCAGC TAAGCCACCGGCTAACTACGTGCCA-top706707689623698693701699692695692711708610625698711717697697649700711667627706Row 26 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Actinobacteriac__Actinobacteriao__Acidimicrobialesf__Acidimicrobiaceaeg__unclassifieds__unclassifiedAAAGTGGCAACACCCGAAGCCGGTG ACGAAAGTGGCAACACCCGAAGCCG ACGAAAGTGGCAACACCCGAAGCCG CGAAAGTGGCAACACCCGAAGCCGG CGAAAGTGGCAACACCCGAAGCCGG-top4262983485054595814044722663244593596321801652666183731012411376614285214122Row 27 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__unclassifiedf__unclassifiedg__unclassifieds__unclassifiedAACGCTGTCTACTAGCTGTTTGTGG AACGCTGTCTACTAGCTGTTTGTGG ATCCGTAGAGATGCGAAGGAACACC ATGGTTAATACCCATTAGCTGTGAC ATGGTTAATACCCATTAGCTGTGAC CCTAAGCGAGATTAGCTTGTTGGTG GGAGAGATCCATGGTTCCCTTCGGG GGAGAGATCCATGGTTCCCTTCGGG GGGTAAAATCCGTAGAGATGCGAAG TAAGCGAGATTAGCTTGTTGGTGAG TGGAGAGATCCATGGTTCCCTTCGG-top6684285196720364718216773149382567284332772125265561613478Row 28 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Rhodocyclalesf__Rhodocyclaceaeg__unclassifieds__unclassifiedAAATCGCATCAGCTAATACCTGGTG AAATCGCATCAGCTAATACCTGGTG AAGAAATCGCATCAGCTAATACCTG AAGAAATCGCATCAGCTAATACCTG ATACCGCATATTCTGTGAGCAGGAA ATACCGCATATTCTGTGAGCAGGAA CCGCATATTCTGTGAGCAGGAAAGC CCGCATATTCTGTGAGCAGGAAAGC CGGGAAGAAATCGCATCAGCTAATA CGGGAAGAAATCGCATCAGCTAATA CGGTTGTGTAAGACAGGCGTGAAAT CGGTTGTGTAAGACAGGCGTGAAAT GACATGTCCAGAAGCCCGAAGAGAT GCCGGGAAGAAATCGCATCAGCTAA GCCGGGAAGAAATCGCATCAGCTAA-top64460964213866340206796546632416013277175772495621273542331124033240327Row 29 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__unclassifiedf__unclassifiedg__unclassifieds__unclassifiedAATTGGTTGAGTTGCTTCTTCTGGC AATTGGTTGAGTTGCTTCTTCTGGC CCAGAAGTTGCTGGGCTAACTCCGT GTCGGAGTTGCTGGTATCGCAGGTC TAGTAACCGCAACTCAGCATATTGC TCAAGGAACCCAGCAACTAGTTGAC-top9053111529110922444772143679019663514868396601179205152317236445273347Row 30 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Bacteroidetesc__Flavobacteriao__Flavobacterialesf__Flavobacteriaceaeg__unclassifieds__unclassifiedACAATGAGCAGCCATCTGGCAACAG AGGTTTAGAGATAGACTTTTCTTCG AGGTTTAGAGATAGACTTTTCTTCG GGTGAAAGGTTGTCGCTTAACGATA TGGTGAAAGGTTGTCGCTTAACGAT-top438544449463234431138259843512943643044449105611592535446430531Row 31 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Comamonadaceaeg__unclassifieds__unclassifiedATGCAAGTCGAACGGTAACGGGCCT CATGCAGTCGAACGGTAACAGGGAA CCAAGCCGACGATCTAGTAGCTAGG CCTTATAGGTGGGGCTACACACGTC GCAAGTCGAACGGTAACGGGCCTTC TACCAAGCCGACGATCTAGTAGCTA TGCCGCGTGCAGGAAGAAGGCCCTA-top583642590503653562496594630643584603306442395545414561368542446445388500533364Row 32 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__unclassifiedo__unclassifiedf__unclassifiedg__unclassifieds__unclassifiedACGCTCATGCACGAAAGCTGGGGAG AGTAGCTGGCCTGAGAGGACGACCA CAGTAGCTGGCCTGAGAGGACGACC CTGACGCTCATGCACGAAAAGCGTG GAATTCTGGGCGTAAAGCGTGCGCA GCCGGTCTCAGTTCGGATTAGAGTC GTTGAGCCCGGGGATTTTACACCTG-top65868162267678650635621625624604649668547530579382586388487532320291383447279Row 33 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Firmicutesc__Clostridiao__Clostridialesf__Lachnospiraceaeg__unclassifieds__unclassifiedACCAGGTCTTGACATCCCGAGAAGT ACCAGGTCTTGACATCCCGAGAAGT ACCAGGTCTTGACATCCCGATGAAA ACCAGGTCTTGACATCCCGATGAAA ACCAGGTCTTGACATCCGATGCATA TGGTGCCGCTGCTAACGCATTAAGC-top57751151436648129031321555525029444119730427434847526443725920521022513791105Row 34 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Comamonadaceaeg__unclassifieds__unclassifiedACACGTCATACAATGGCTGGAGCAA AGCTTTGCTAATACCGCATACGATC GCGCTTGTGACTGCAAAGCTGGAGT GCGCTTGTGACTGCAAAGCTGGAGT GTACGGAACGAAAAGGCTCTGGTTA GTACGGAACGAAAAGGCTCTGGTTA-top358526475179538323244442398422354531151115953272394411172747610719213331035Row 35 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Comamonadaceaeg__Acidovoraxs__unclassifiedAACCCTTGCCATTAGTTGCTACGAA ACGTACTAACGCGTGAAGTTGACCG CCACCTTTGACATGTACGAAATCCT CCTTCGGGTTGTAAACTGCTCTTGT CCTTCGGGTTGTAAACTGCTCTTGT CGTGCGCAGGCGGTTATATCAGACC GACATGTACGGAATCCTTTAGAGAT GACATGTACGGAATCCTTTAGAGAT GGTGAGTTATACATCGGAACGTGCC GTAACGAGCTAACGCGTGAAGTTGA GTTCTCTGGGCCTGTACTGACGCTG TAAAGCGTGCGCAGGCGGCTATCCA TAAAGCGTGCGCAGGCGGCTATGTA TGTTACCCACCTTTGACATGTACGG TTCTGACGCTCATGCACGATAGCGT TTGCCAATAGTTGCTACGAAAGGGC-top523540360392534482366396508496345463259209169316214393121264196121200136229173Row 37 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Comamonadaceaeg__Acidovoraxs__unclassifiedACGCTCATGCACGAAATCGTGGGGA CGTGCGCAGGCGGTTATATCAGACC CTACGGATGAAAGCAGGGGATCGCA GTTCTCTGGGCCTGTACTGACGCTG TGCTTCGAGAGAGCCGTAACACAGG TGCTTTTGTACGGAACGAAATAGCT-top423480236483964313802873734132263505662141432632434219720913812318590120156Row 38 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Comamonadaceaeg__Acidovoraxs__unclassifiedAGTACGGCGCAAGGTTGAAACTCAA ATCTCGAAAGCCGATCTCAGTTCGG CGAAAGGGCACTCTATTGGGACTGC GAGTACGGCGCAAGGTTGAAACTCA GGAGTACGGCGCAAGGTTGAAACTC GGCCGCGAGGTTGAAACTCAAAGGA GGTTCTCTGGGCCTGTACTGACGCT GTAACGAAGCTAACGGCGTGAAGTT GTACGGCGCAAGGTTGAAACTCAAA TAACGAAGCTAACGGCGTGAAGTTG TCCGTTGATATGCGGAGGAACACCA-top5035103272365084593633984735203664464520517920217932712226219513799128276143Row 39 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Moraxellaceaeg__Acinetobacters__unclassifiedAACGCCGCGTGAGTCATGAAGGTTT AGGAATACCCGATGGCGAAGGCAGC AGGAATACCGATGGCGAAAGCAGCC ATATGGAAGAATACCAGTGGCGAAG ATGCCTTAACATGCAAGTCGAACGG ATGCTCGAAAGCGTGGGTAGCAAAC CACATGCAAGTTGAACGGCAGCATG CGTAAAGCGTGCGTAGGCGGTTACT CGTAAAGCGTGCGTAGGCGGTTATT GCCTTACACATGCAAGTTCGAACGG GGCCTTAACTGACGCTGAGGTACGA TGGAGGAATACCGATCGCGAAGGCA TGGTAACGGCGCACCAAGGCGAAGA-top538594402185531574614492404407355556535370385544470618375394312376540278345453Row 40 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Pseudomonadalesf__Moraxellaceaeg__Acinetobacters__Acinetobacter_johnsoniiATCTTCGGACCTTGCGCTACAGGGG CGGAGGAATACCGATGGCGCAGGCA GACGTTACGGCAGAATAAGCACCGG GCTAATACCGCATACGCCTACGGGG GTGGTGCAGCTAACGCGATAAGTAG TCGGGCCTTAGTGGCGCAGCTAACG TGTGACGTTACTCGCAGAATAAGCA-top44447540017341245752137017532629852966301284332216347282317256242308148241319Row 41 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Aeromonadalesf__Aeromonadaceaeg__Aeromonass__Aeromonas_encheleiaGAATTGCATTTAAAACTGTCCAGCT GAATTGCATTTAAAACTGTCCAGCT GGAATTGCATTTAAAACTGTCCAGC TGCATTTAAAACTGTCCAGCTAGAG TGCATTTAAAACTGTCCAGCTAGAG-top103310107491979667946496422609571413639663748108172761897011Row 42 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Aeromonadalesf__Aeromonadaceaeg__Aeromonass__unclassifiedAAAGCACTTTCAGCGAGGAGGAAAG AACTGCCAGCTGTGACGTTACTCGC AACTGCCAGCTGTGACGTTACTCGC ATCTACTGGCTGTGACGTTACTCGC CGCGCGTAGCGTGGTTTGTTAAGTT CTTTCAGCGAGGAGGAAAGGTTGTA-top1401861092482152222721291441759117414658856844568245540181260322418190285433Row 43 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Gammaproteobacteriao__Vibrionalesf__Vibrionaceaeg__Aliivibrios__unclassifiedAACTGGTGAACTAGAGTGCTGTAGA GAAACTGGTGAACTAGAGTGCTGTA GGAGAACGCTCACCACTTTGTGGTT GGAGAACGCTCACCACTTTGTGGTT TCGGGGAGGACGCTCACCACTTTGT-top1141551612391182015712519551743943648112134555553503565273521653487652675Row 44 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Tenericutesc__Erysipelotrichio__Erysipelotrichalesf__Erysipelotrichaceaeg__Allobaculums__Allobaculum_sp_ID4CCTTCGGGTCTCCAGTGGCGAACGG GAATGATTGGGCGTAAAGCATCTGT TTCGGATATCCAGTGGCGAACGGGT TTCGGATATCCAGTGGCGAACGGGT TTGTCTTTCCAGTGGCGAACGGGTG TTGTCTTTCCAGTGGCGAACGGGTG-top535286322206298257293216225306287313414708701673178173598213706190167506313263Row 45 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Alphaproteobacteriao__Rhodobacteralesf__Rhodobacteraceaeg__Antarctobacters__Antarctobacter_heliothermusAACTGCCTCATAAACTCCTGGTCTT AACTGCCTCATAAACTCCTGGTCTT ACTGCCTCATAAACTCCTGGTCTTG ACTGCCTCATAAACTCCTGGTCTTG CTGCCTCATAAACTCCTGGTCTTGA CTGCCTCATAAACTCCTGGTCTTGA-top70552611192381125268312714275412253710019060770604640647370332537Row 46 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Aquabacteriaceaeg__Aquabacteriums__unclassifiedAAAGCGTACGCAGGCGGCTTTGCAA AAAGCGTACGCAGGCGGCTTTGCAA AATTTCGCAGAGATGTGGAAGTGCT ATACCTCGGGAGGATGACGGTACCT CTAATCCCAGAAAACCGGTCGTAGT GATGACGTCAGGTCCTCATGGCCTT-top354608324362574193470456586536471442318105114367242414106376299139196114291141Row 47 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Aquabacteriaceaeg__Aquabacteriums__unclassifiedAATGGCCGGTACAGAGGGCTCCGAT ATGCCGCGTGCAGGAAGAAGATCCT CTACAATGGCCGGTACAGTGGGCGT CTTCGCGAGGAGGAGCCAATCCCAA GCAATACCGCGTGCAGGAAGAAGGC GCCAACCAGCGAGGGGGAGCCAATC GGTAAAGGCCTACCAAGGCAGAGAT-top47456240591562318459461560540475501423226225313236401183329294265243150314210Row 48 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Aquabacteriaceaeg__Aquabacteriums__unclassifiedAATACCTCGGGAGGATGACGGTACC AATACCTCGGGAGGATGACGGTACC ACCTGCAAAGGAGGGCGATTACCAC ATACCTCGGGAGGATGACGGTACCT TGCAGAAGATGTGGAAGTGCTCCGA-top2454482282737712822727043839325434936412570171122283961991441081179587108Row 49 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
p__Proteobacteriac__Betaproteobacteriao__Burkholderialesf__Comamonadaceaeg__Aquamonass__unclassifiedAATGGGCGCAGCCTGATCCAGCCAT ACGTTTCGTAGTCCGGATCGCAGTC ATGGGCGCAGCCTGATCCAGCCATG GGGATGACTCAAGTCCTCATGGCCC GGGATGACTGTCAAGTCCTCATGGC-top57362457324585596608611536553577548652504503590553661647439473595683424390578Row 50 of 201Accessed on 2022-05-19 23:43:26, Linda; 05/15/2019. NOAA Fisheries Northwest Fisheries Science Center. Sablefish GI microbiome & histology: Comparative bacterial and archaeal gastrointestinal abundances from sablefish on different diets (
  • 1 - 50 of 201